activity. Cymbopogon winterianus is the citronella oil–yielding species cultivated in India. It essential oil can kill up to 99.9% of the bacteria so it

was assume that no endophytic bacteria can survive in the leaf of Cymbopogon winterianus. We isolated the endophytic bacteria from the leaf of

Cymbopogon winterianus collected from the foothill of Karbi Angalong in Assam India. The endophyte bacteria were isolated by modified leaf

impression method. The bacteria were grown from the edge of the cut site of the leaf and in presence of essential oil of the leaf the bacteria shows

growth which confirms it as endophytic bacteria. Two specific types of bacteria were seen after multiple cultures. The culture were identified by 16s

ribosomal RNA using 27F (AGAGTTTGATCATGGCTCAG) as forward primer and 1492R (TACGGCTACCTTGTTACGACTT) as reverse

primer found that two species of bacillus were found which were identified by NCBI BLAST. The strain were submitted in nucleotide database of

NCBI