Volume : II, Issue : XI, November - 2013

16S rRNA partial sequence analysis of Ralstonia solanacearum isolated from wilting ginger (Zingiber officinale) and potato (Solanum tuberosum) crops in Hassan District, Karnataka.

Makari Hanumanthappa K, Palaniswamy M, Angayarkanni J, Manjunath Dammalli, Vivek Chandramohan

Abstract :

The aim of the research work is to identify phytopathogenic Ralstonia solanacearum, induced wilting symptoms in potato and ginger crops in Karnataka state. Ralstonia solanacearum is a soil inhabiting Gram–negative bacterium causes wilt leading to devasting lethality in many vegetable crops especially in solanaceous plants. It infects through the roots specifically invading in the host and multiplying in the xylem vessels in potato crops leads to wilting. The bacteria were isolated from infected potato and ginger tubers. The isolates were characterized by TTC, 16s ribosomal sequence analysis was done using 16S rRNA F8 universal primers (16s rRNA F–5’AGAGTTTGATCCTGGCTCAG 3’, 16s rRNA R–5’ACG GCTACCTTGTTA3’) and phylogenetic analysis were used molecular relatedness of the isolated phytopathogenic bacteria. 16S rRNA sequences were analyses by CLC genomics workbench software for Sequence information, atomic composition, nucleic acid distribution, nucleotide distribution histogram and secondary structure prediction. The findings of the research greatly anticipated for the identification and characterization of the phytopathogenic R. solanacearum.

Keywords :

Article: Download PDF   DOI : 10.36106/ijsr  

Cite This Article:

Makari Hanumanthappa K , Palaniswamy M, Angayarkanni J, Manjunath Dammalli, Vivek Chandramohan / 16S rRNA partial sequence analysis of Ralstonia solanacearum isolated from wilting ginger (Zingiber officinale) and potato (Solanum tuberosum) crops in Hassan District, Karnataka / International Journal of Scientific Research, Vol.2, Issue.11 November 2013


Number of Downloads : 1053


References :