Volume : II, Issue : XI, November - 2013
16S rRNA partial sequence analysis of Ralstonia solanacearum isolated from wilting ginger (Zingiber officinale) and potato (Solanum tuberosum) crops in Hassan District, Karnataka.
Makari Hanumanthappa K, Palaniswamy M, Angayarkanni J, Manjunath Dammalli, Vivek Chandramohan
Abstract :
The aim of the research work is to identify phytopathogenic Ralstonia solanacearum, induced wilting symptoms in potato and ginger crops in Karnataka state. Ralstonia solanacearum is a soil inhabiting Gram–negative bacterium causes wilt leading to devasting lethality in many vegetable crops especially in solanaceous plants. It infects through the roots specifically invading in the host and multiplying in the xylem vessels in potato crops leads to wilting. The bacteria were isolated from infected potato and ginger tubers. The isolates were characterized by TTC, 16s ribosomal sequence analysis was done using 16S rRNA F8 universal primers (16s rRNA F–5’AGAGTTTGATCCTGGCTCAG 3’, 16s rRNA R–5’ACG GCTACCTTGTTA3’) and phylogenetic analysis were used molecular relatedness of the isolated phytopathogenic bacteria. 16S rRNA sequences were analyses by CLC genomics workbench software for Sequence information, atomic composition, nucleic acid distribution, nucleotide distribution histogram and secondary structure prediction. The findings of the research greatly anticipated for the identification and characterization of the phytopathogenic R. solanacearum.
Keywords :
Article:
Download PDF
DOI : 10.36106/ijsr
Cite This Article:
Makari Hanumanthappa K , Palaniswamy M, Angayarkanni J, Manjunath Dammalli, Vivek Chandramohan / 16S rRNA partial sequence analysis of Ralstonia
solanacearum isolated from wilting ginger (Zingiber officinale) and potato (Solanum
tuberosum) crops in Hassan District, Karnataka / International Journal of Scientific Research, Vol.2, Issue.11 November 2013
Number of Downloads : 1365
References :
Makari Hanumanthappa K , Palaniswamy M, Angayarkanni J, Manjunath Dammalli, Vivek Chandramohan / 16S rRNA partial sequence analysis of Ralstonia solanacearum isolated from wilting ginger (Zingiber officinale) and potato (Solanum tuberosum) crops in Hassan District, Karnataka / International Journal of Scientific Research, Vol.2, Issue.11 November 2013
Our Other Journals...
-
Indian Journal of
Applied Research Visit Website -
PARIPEX Indian Journal
of Research Visit Website -
Global Journal for
Research Analysis Visit Website
/images/ijar-text.png)
MENU
MENU